Codons to amino acids and amino acids to codons

I’m trying to write my paper and I’m stuck. Can you help?

Our reliable essay writing service is a great opportunity for you to save your time and receive the best paper ever.

In this experiment, you will investigate and translate codons to amino acids and amino acids to codons.ProcedureReview the codon chart in Table 1, found in the background. The codon chart is also readily available in text books and websites.Examine the first set of codons in Data Table 1. Convert the codons to the amino acids they code for and record in Data Table 1. The 3 letter codes for amino acids may be used in place of writing the entire name for each amino acid. (example: CTT = Leucine = Leu)Repeat step 2 for the remaining 4 sets of codons in Data Table 1.A set of primers was designed to code for a series of amino acids. Review the codon/amino acid pairs in Data Table 2. Determine if the codons correctly code for the desired amino acid and record “yes” or “no” in Data Table 2. For each amino acid that does not contain the correct set of codons, provide the correct set of codons in the “fixed codons” row of Data Table 2.Note: If there is more than one option for the correct set of codons, you only need to choose one of the correct codon options. If the codons are correct, then you will not fill in the “fixed codons” row of Data Table 2.Review the amino acids in Data Table 3.For each amino acid listed in Data Table 3, provide the codon(s) that will code for each amino acid or stop codon. If an amino acid or stop codon has multiple options, list all codon options.Review the DNA sequence in Data Table 4.Design a set of primers (5′ to 3′ and 3′ to 5′) that covers the first 20 and last 18 nucleotides of the sequence. Record each set of primers in Data Table 4.Exercise 1 – Questions1. The first amino acid in all protein sequences was the same in Data Tables 1, 2, and 3. What was the amino acid and why is this amino acid the first in all of these protein sequences? Explain your answer.DataExperiment 1Exercise 1BE Data Table 1Data Table 2Data Table 3Data Table 4Data Table 1: Codons to Amino Acids#CodonsAmino AcidsATGACAAACAGTAGAGGTGGCTATTGTCCG2ATGATATTGTTTTCATGGAACCCCGAGAGGTGG3ATGACACACTGCAAAGAAGCGGCACCCCCGTGA4ATGCAATACTTATCAAAAAAGGGCGAG5ATGCGCCGGATGCATTTTGTGGTAGAGGCATAA

Plagiarism-free and delivered on time!

We are passionate about delivering quality essays.

Our writers know how to write on any topic and subject area while meeting all of your specific requirements.

Unlike most other services, we will do a free revision if you need us to make corrections even after delivery.

ORDER PROCESS

How it Works

c

Place an order

Fill out the order form.

Attach any custom instructions that is required to complete your order.

Make Payment

Pay online safely.

The order form will redirect you to a payment page.

Receive Order via Email

Once the order is complete, we’ll send it via the email provided on the order form.

All Papers are Written from Scratch