Genomic sequences and mRNA sequence

I’m trying to write my paper and I’m stuck. Can you help?

Our reliable essay writing service is a great opportunity for you to save your time and receive the best paper ever.

Two genomic sequences and one mRNA sequence is available for analysis. One gonomic sequence is the gene sequence and the other is the promoter sequence for the gene. You have cloned and sequenced this novel (never sequenced or identified before) gene and promoter from human mammary tissue. You have also characterized the mRNA of the gene by identifying the exon/intron boundaries. The exons are located at base pairs 1-510, 1401-1640, 2299-2538, 2941-3081, and 3672-5121 of the genomic sequence. After some initial database searches, you think that the gene is derived by exon shuffling between several different genes. Your job is to identify and characterize the promoter, gene, mRNA, and protein and decide if your exon shuffling theory is correct. Can someone give me a quick idea on their findings and a proposed function of this gene in the mammary gland. (and explain to me what this question is asking)The sequences can be found below:Gene:gcacccctgggaaggtatggaggtggactgatgcaaaattcagttcagacctgtggaatatgtccacactaagtagcacttctcttttatgtgccacgatgaccagcgccctctgtgtggagtggcgtccgccttcttacaggcatctagatggaggttaggggaatgaaatgcagagtctaggcaagacttgcaggggaactcctaacacatatgtattagccaaatactgggtaagagtccttgtgttgagaccttgaattcagcttccgctcagacctttgggcaaagcctcctccctcagtggctgtgctctcttcaggttctacaggccaccttcccaggtgcattttgtgacaagtgtagtcggtaattaactctccaacagtgactctcctgttcttgctgtctttgcctgcaggtatggcctgtctctggtcattctcatggccatcatgtttcctctcactcctcctcctcctcctcctccaactctcatgttcatatgccaggtacaacagatggatggctaaagggccaatttttgtaaagccaatgtccaaaagaaatgattacaaaagaaggatcaaaagcccaagaaagttttaacccttaggcaacaaaagggggtgagtgaggcgaggtaggagaaagactccaggaggaaaacttttgatttagatagaagtcatcttcaagaaggcagatagcaggggaaagcgcccaacacaaatacacacagggtctcctgcctggccctttctaccctcattgttgcatagtgaatgtttgagctaagtttcaaaaatgctgtgacctagacaatatttctctggttccagagggcttcacgggaggacagaaggtctggggctagacttttctatggtagccccttgctgagtcccccccaccaacccccctgccagacatctgacacctccaaagctctcttcttagaggctggatccagcctcttgggtggaggtgtaagggcagggtatgcgccattaaagcctgctctgcagaatacctagtcagagtccatctttctggcgagcatataaatccctttgaatgctgcagtctgatgcaatcagcagcttctttgcccttttgctgaatggtagcatgcatagtagatgaatgagtagctgaatagggaatatacaggcctgagggaagaaaataggaataaaaaatgtgaatatttacaaaagaatagaagcgggttgagatgctcaacttctaattttttggacattttggcagaaaaatcacatctcttagtgtggtgcatccttcttaacacatgctttgatcaaataccctttgctgaatcgagtaggtaacccaggtagccttcctgcttggcctttctctctgtgtgtccacacagttcagtaacactctcatgtaaagcctcaggtttcacattctcatcatattatgtatcatgggtacggcaaccaccaggtaaaggtctcgagtggctcggttatatcggttcagacgtatcatattcagaggcctcatataaaggtcgggtaacaatctcaaaagacaactcaaaaaacgacgtatcactcacaatctcaaacctccgggtagaggacacaggtacatattattgtgccgtaagtgtaagctgctctgatggaaggagaaagccacttgggaccccaggtctgccctgattcctgaccagctttcccttgtatcttaccagtcagtaaagggtgggatagagcgcatatccgtcagctaccttccttcacacctcatagcccatgccgtgatgctgctctctgaatgcttgccagtggtttgcaagcaaaaatctaaatgatacgatgaagtcacttttaggccagaacccttgggactttctgcttaatgtggggagcagaactccagagaagggacataagttgctgaaggcacaaggaaaagatgtcacagaagtcaattgactgggccaacatcctggctctcgctcatcctctctctctctctctctctctctctctctctctctctctctctctctctctcaatgtggcatattgtggcccatgcgcaggagagtggagcgagggaaaggactagggctttaggagctgaggagaacagttctgctgggaaccagttacagggccaagggtagccaattagcctggaacttgggttgtccacctgtgaaatgagagaggtgagctatccatcttagtactccatctatttctgacctccgtggtcctctgctcatctcttccttgcccaattcctcccctgcgttcagtaacactctcatgtaaagcctcaggtttcacattctcatcatattatgtatcatgggtacggcaaccaccaggtaaaggtctcgagtggctcggttatatcggttcagacgtatcatattcagaggcctcatataaaggtcgggtaacaatctcaaaagacaactcaaaaaacgacgtatcactcacaatctcaaacctccgggtagaggacacaggtacatattattgtgccgtaaggacatgtgagttgagctgaagtaacccaagtctagggaaagaaatggttttttccacccgatagcctcaggactgagttgtgttagactgagtgggtcaggttagatggagtggccacactttgggatgttgaaaaggtgaattctactctgagtcatctaactatgcttggttgtgtaagagtcctacaggtacagactcttgatgtgaatgttccatgttgtatggtcttggtgaaaagagactgctcggatcctgactccagtatatgttctaagggcctagctactagacttgtgtcttgcggaaattctcaagccttctactccactgtgctggccctgcttctaacttgctgctctgatcctattgaaaaggagccttgtgtgtctcttctcgaggtctgactgttcttcagttgcctagccttctgtcccttacaagcttttctttcagagaggagtgtgctggggtgagatatctccagaaacatcagtgtgcatcactgctgcctctgggcacctttccttctctctgcctgttagtactaagcctgctgctcacacttaacagtattctcatataccaggcttgcctgagcaagcgtaaccataactccttaaggacactaattgtatttaatctattccactacatctccagtgggacttcagcaaattaaacacccataactgtttggctggggatggcatggacttagtgggcgatcaggatcctcctggcaggaagtattcattttgtttgggggttcactagatgttgtgtcagtatgtagtctccgcatgagacaggaagaaagagcctccactcttcatatcgtaactccctatttgattctgttctcattacactgtaggtctttgggccaggtcaagattttctgggatttccctaaatgatggaagaaaggggtacttttcattatcaacctcctcttgttccactgtttatgaatcttttgtatcaaaggctgtggacaaggctggagatggtttgggaaagacagaaggacaaatgagaggaattttttgtgaattctgtcttataacagtatctgttggggaacctccatcttttcagcaatcacaactggtattttctttacccgatatgctagcaagtgctctgtattctgtacttgggcagtgcaggcattgagcaacataagctgtgggggaagaaaagtcccaacaccaatttaagaactgtcacactgacgttaccagaaggcccagtcttgccttctaagctgtcagtggcattaaagtccttcagaaatacctattcacacctatgtccccagacactgtaccaagaaagccaaaggaaatatccacggtcctgatgggaaacctgtcataagtaagtaggcaggttgaatgcatctacaataaagatcctagPromoter:aaggctgctcctccccccaccccgaataaatacacttggtcacctgtgggcaggcttctcGCACCCCTGGGAAGGTATGGAGGTGGACTGATGCAAAATTCAGTTCAGACCTGTGGAATATGTCCACACTAAGTAGCACTTCTCTTTTATGTGCCACGATGACCAGCGCCCTCTGTGTGGAGTGGCGTCCGCCTTCTTACAGGCATCTAGATGGAGGTTAGGGGAATGAAATGCAGAGTCTAGGCAAGACTTGCAGGGGAACTCCTAACACATATGTATTAGCCAAATACTGGGTAAGAGTCCTTGTGTTGAGACCTTGAATTCAGCTTCCGCTCAGACCTTTGGGCAAAGCCTCCTCCCTCAGTGGCTGTGCTCTCTTCAGGTTCTACAGGCCACCTTCCCAGGTGCATTTTGTGACAAGTGTAGTCGGTAATTAACTCTCCAACAGTGACTCTCCTGTTCTTGCTGTCTTTGCCTGCAGGTATGGCCTGTCTCTGGTCATTCTCATGGCCATCATGTTTCCTCTCACTCCTCCTCCTCCTCCTCCTCCAACTCTCATGTTCATATGCCTCAGTAACACTCTCATGTAAAGCCTCAGGTTTCACATTCTCATCATATTATGTATCATGGGTACGGCAACCACCAGGTAAAGGTCTCGAGTGGCTCGGTTATATCGGTTCAGACGTATCATATTCAGAGGCCTCATATAAAGGTCGGGTAACAATCTCAAAAGACAACTCAAAAAACGACGTATCACTCACAATCTCAAACCTCCGGGTAGAGGACACAGGTACATATTATTGTGCCGTATCAGTAACACTCTCATGTAAAGCCTCAGGTTTCACATTCTCATCATATTATGTATCATGGGTACGGCAACCACCAGGTAAAGGTCTCGAGTGGCTCGGTTATATCGGTTCAGACGTATCATATTCAGAGGCCTCATATAAAGGTCGGGTAACAATCTCAAAAGACAACTCAAAAAACGACGTATCACTCACAATCTCAAACCTCCGGGTAGAGGACACAGGTACATATTATTGTGCCGTAACACCATGGATCGTAGCCGTAGCCATCATCCTCCTCGCCCTCGGTTTCCTCACAATCGGTTCAATCTTCTTCACATGGAAACTCTATAAAGAGCGGTCATCACTCCGGAAAAAAGAGTTCGGTTCAAAAGAGCGGCTCCTCGAGTATGAGCTCGGTGAGAAACTCGGTTCAGGTGCCTTCGGTAAAGTATATAAAGGTAAACATAAAGACACAGGTGAGATCGTAGCCATCAAAATCCTCAAAAAACGGTCACTCTCAGAGAAAAAAAAACGGTTCCTCCGGGAGATCCAAATCCTCCGGCGGCTCTCACATCCAAACATCGTACGGCTCCTCGGTGTATTCGAGGAGGACGACCATCTCTATCTCGTAATGGAGTATATGGAGGGTGGTGACCTCTTCGACTATCTCCGGCGGAACGGTCTCCTCCTCTCAGAGAAAGAGGCCAAAAAAATCGCCCTCCAAATCCTCCGGGGTCTCGAGTATCTCCATTCACGGGGTATCGTACATCGGGACCTCAAACCAGAGAACATCCTCCTCGACGAGAACGGTACAGTAAAAATCGCCGACTTCGGTCTCGCCCGGAAACTCGAGTCATCATCATATGAGAAACTCACAACATTCGTAGGTACACCAGAGTATATGGCCCCAGAGGTACTCGAGGGTCGGGGTTATTCATCAAAAGTAGATGTTTGGAGCCTCGGTGTTATTCTCTATGAACTCCTCACTGGTAAACTCCCGTTCCCGGGTATTGATCCGCTCGAAGAACTCTTCAGAATTAAAGAAAGACCGAGACTCAGACTCCCGCTCCCGCCGAATTGCAGCGAAGAACTCAAAGATCTCATTAAAAAATGCCTCAATAAAGATCCGGAAAAAAGACCGACTGCAAAAGAAATTCTCAATCACCCGTGGTTCTAAAGTATTCATTTTGTTTGGGGGTTCACTAGATGTTGTGTCAGTATGTAGTCTCCGCATGAGACAGGAAGAAAGAGCCTCCACTCTTCATATCGTAACTCCCTATTTGATTCTGTTCTCATTACACTGTAGGTCTTTGGGCCAGGTCAAGATTTTCTGGGATTTCCCTAAATGATGGAAGAAAGGGGTACTTTTCATTATCAACCTCCTCTTGTTCCACTGTTTATGAATCTTTTGTATCAAAGGCTGTGGACAAGGCTGGAGATGGTTTGGGAAAGACAGAAGGACAAATGAGAGGAATTTTTTGTGAATTCTGTCTTATAACAGTATCTGTTGGGGAACCTCCATCTTTTCAGCAATCACAACTGGTATTTTCTTTACCCGATATGCTAGCAAGTGCTCTGTATTCTGTACTTGGGCAGTGCAGGCATTGAGCAACATAAGCTGTGGGGGAAGAAAAGTCCCAACACCAATTTAAGAACTGTCACACTGACGTTACCAGAAGGCCCAGTCTTGCCTTCTAAGCTGTCAGTGGCATTAAAGTCCTTCAGAAATACCTATTCACACCTATGTCCCCAGACACTGTACCAAGAAAGCCAAAGGAAATATCCACGGTCCTGATGGGAAACCTGTCATAAGTAAGTAGGCAGGTTGAATGCATCTACAATAAAGATCCTAG

Plagiarism-free and delivered on time!

We are passionate about delivering quality essays.

Our writers know how to write on any topic and subject area while meeting all of your specific requirements.

Unlike most other services, we will do a free revision if you need us to make corrections even after delivery.

ORDER PROCESS

How it Works

c

Place an order

Fill out the order form.

Attach any custom instructions that is required to complete your order.

Make Payment

Pay online safely.

The order form will redirect you to a payment page.

Receive Order via Email

Once the order is complete, we’ll send it via the email provided on the order form.

All Papers are Written from Scratch